Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 downregulation on terminal cell differentiation, tight junction formation, and E-cadherin membrane localization in colon cells. Caco-2 wild-type (WT) cells and clones of 15-LOX-1 shRNA stably transfected Caco-2 cells with either successful [15-LOX-1 KD (+)] or unsuccessful [15-LOX-1 KD (−)] 15-LOX-1 knockdown were treated with sodium butyrate (NaBT) for 48 hours and then harvested and processed for 15-LOX-1 expression by Western blotting (Fig. 5A) and alkaline phosphatase enzymatic activity as a marker of cell differentiation (Fig. 5B). Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). Positive control in A is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction on days 0 and 14 after confluence. Values are the means and standard errors of the means of triplicate measurements. * P < 0.0001 (two-way analysis of variance). D, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were evaluated for tight junction formation using FITC-dextran fluorescence permeability assay on day 14 after confluence. Relative fluorescence intensity values (relative to that of wild-type Caco-2 cells) at various time points are shown. Values are the means and standard errors of the means of triplicate measurements of three experiments. * P < 0.008 (t-test). E, 15-LOX-1 KD (+) and 15-LOX-1 KD (−) cells were cultured for the indicated numbers of days after confluence. Equal protein amounts from cytoskeleton-associated (insoluble) and total cell lysates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis separation followed by Western blotting. Band intensities (lower panel) for the blotted E-cadherin were quantified using an Odyssey fluorescent imager (LI-COR Biosciences, Lincoln, NE) and Odyssey software.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Cell Differentiation, Clone Assay, shRNA, Stable Transfection, Transfection, Expressing, Western Blot, Activity Assay, Marker, Positive Control, Plasmid Preparation, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Fluorescence, Permeability, Polyacrylamide Gel Electrophoresis, Software

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and differentiation of primary NHBE cells. Primary NHBE cells were grown for 3 weeks in an undifferentiated state in immersion cultures or in air-liquid interface cultures to induce terminal differentiation into bronchial epithelial-like structures. Cells were then harvested and processed for quantitative real-time reverse transcription-polymerase chain reaction (panel A, differentiated vs. undifferentiated NHBE cells, P = 0.0005), Western blotting (panel B), and 13-HODE levels by liquid chromatography tandem mass spectroscopy (panel C, differentiated vs. undifferentiated NHBE cells, P = 0.0002). + represents 15-LOX-1 positive control (HCT-116 colon cancer cells transfected with 15-LOX-1 expression vector).

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Reverse Transcription Polymerase Chain Reaction, Western Blot, Liquid Chromatography, Tandem Mass Spectroscopy, Positive Control, Transfection, Expressing, Plasmid Preparation

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 and P16 mRNA and protein expression levels in cancer cell lines. A and B, A total of 128 cancer cell lines (Supplementary Table S1) were cultured and processed for 15-LOX-1 (panel A) and p16 (panel B) mRNA by quantitative real-time reverse transcription-polymerase chain reaction. Dots in the dot plots are means of triplicate measurements from each cell line. The relative expression levels were calculated relative to expression of the calibrator sample (differentiated NHBE cells). Solid lines represent the median value for each group. C, 15-LOX-1 relative expression levels in cancer cell lines compared to the level in Caco-2 cells terminally differentiated by sodium butyrate treatment. 15-LOX-1 mRNA measurements are as in panel A but with terminally differentiated Caco-2 cells as the calibrator sample. Dots in the dot plots are means of triplicate measurements from each cell line. The solid line represents the median value for the relative expression levels. D, 15-LOX-1 protein expression in cancer cell lines. Cell lines—including cell lines with 15-LOX-1 mRNA expression levels nearly equal to or greater than the level in differentiated Caco-2 cells or NHEK—were cultured, processed for Western blotting, and probed with 15-LOX-1 antibody. Three repeated experiments yielded similar results.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: 15-LOX-1 expression in normal and cancerous lung cells. A, Non-tumorigenic immortalized normal human bronchial epithelial cells (HBEC) (HBEC3KT, HBEC6KT, HBEC12KT, and HBEC24KT) and H460 lung cancer cells were grown in air-liquid interface cultures that were paraffin embedded, sectioned, and examined with hematoxylin-eosin (H&E) staining and 15-LOX-1 immunohistochemistry staining (IHC). B, Paired normal and non-small cell lung cancer tissues were immunohistochemically stained for expression of 15-LOX-1. Values are the intensity scores for 15-LOX-1 immunohistochemistry cytoplasmic staining (IHC intensity scores) in each individual case as listed in the table. NA: tissue samples were not available.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, Staining, Immunohistochemistry

Journal: Cancer prevention research (Philadelphia, Pa.)

Article Title: Mechanistic Contribution of Ubiquitous 15-Lipoxygenase-1 Expression Loss in Cancer Cells to Terminal Cell Differentiation Evasion

doi: 10.1158/1940-6207.CAPR-10-0280

Figure Lengend Snippet: Effects of 15-LOX-1 expression on Caco-2 cell spontaneous enterocyte differentiation. A and B, Effects of 15-LOX-1 shRNA on induced 15-LOX-1 expression during Caco-2 cell spontaneous enterocyte differentiation. Caco-2 cells were stably transfected with either non-targeted shRNA (control shRNA) or 15-LOX-1 shRNA and cultured for 14 days after confluence. Cells were collected at the time of confluence (0) and 14 days after confluence. 15-LOX-1 mRNA levels were measured by quantitative real-time reverse transcription-polymerase chain reaction (A) and Western blotting (B). The relative expression levels in A were calculated relative to the expression level of the calibrator sample (control shRNA, day 0). Values shown are the means ± standard deviations of triplicate measurements. * P < 0.0001. Positive control in B is cell lysate protein extract from HCT-116 cells transfected with a 15-LOX-1 expression vector. C, Effects of 15-LOX-1 on the morphology of Caco-2 cells. Caco-2 cells were cultured as described for panel A for 14 days after confluence and then fixed and examined by transmission electron microscopy. Magnifications are as indicated for each of the images. D and E, Effects of 15-LOX-1 downregulation on cell-cell contact and tight junction assembly. Caco-2 cells transfected with 15-LOX-1 shRNA or control vector were cultured to induce terminal differentiation for 14 days after confluence. Cells were processed for immunofluorescence using either ZO-1 or E-cadherin antibodies. Representative confocal microscope-captured images for staining with ZO-1 (D) and E-cadherin (E) are shown. The images for ZO-1 in the right column represent enlarged sections of the images in the left column. These enlargements demonstrate the differences in the plasma membrane structure of the cells. Bar, 10 µm.

Article Snippet: We selected the pRS-15-LOX-1-shRNA-83 vector (OriGene) containing 29-base-pair shRNA forward sequence of 15-LOX-1: AGGCTTCTCTCCAGATGTCCATCACTTGG for the stable transfection experiments on the basis of preliminary studies showing efficient 15-LOX-1 gene downregulation.

Techniques: Expressing, shRNA, Stable Transfection, Transfection, Cell Culture, Reverse Transcription Polymerase Chain Reaction, Western Blot, Positive Control, Plasmid Preparation, Transmission Assay, Electron Microscopy, Immunofluorescence, Microscopy, Staining

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 3. CLASP2 Is Required for Neural Progenitor Differentiation and Controls Terminal Division of Neural Progenitor Cells (A) Mouse embryos were electroporated in utero with GFP-tagged scrambled control or CLASP2 shRNA plasmids at E14.5 and analyzed at E16.5. Immuno- staining for mitotic marker PH3 (red) shows more dividing cells at the ventricular zone in CLASP2 knockdown cells within the first 20 mm bin (control, n = 4 brains; CLASP2 shRNA, n = 4 brains). For additional data, see Figure S2. (B–G) Mouse embryos were electroporated in utero with GFP-tagged scrambled control (B) or CLASP2 shRNAs (C) at E14.5. The pregnant dams were injected intraperitoneally with EdU 24 hr following electroporation and embryos were analyzed at E16.5. Coronal brain sections immunostained for EdU (red) and Ki67 (blue) showed an increased in the percentage of electroporated cells that were positive for Edu (D) and Ki67 (E) located in the VZ (bin area 1, within the first 20 mm) in CLASP2 knockdown cells. There was no effect of CLASP2 shRNA on the total number of EdU-positive cells (F); however, there was a significant decrease in the number of EdU-positive/Ki67-negative cells exiting the cell cycle (G). Arrowheads for (B) represents GFP-positive cells, which is EdU-positive/Ki67-negative in

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: In Utero, Control, shRNA, Immunostaining, Marker, Knockdown, Injection, Electroporation

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 4. CLASP2 Is Necessary for Radial Migration of Cortical Projection Neurons in the Mammalian Brain (A–C) Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at E16.5 (A, control, n = 6 brains; CLASP2 shRNA, n = 6 brains), P0 (B, control, n = 3 brains; CLASP2 shRNA, n = 6 brains), and P14 (C, control, n = 4 brains; CLASP2 shRNA, n = 6 brains). Coronal sections of the cortex were visualized for transfected GFP-positive neurons (green) and cell nuclei (Hoechst 33342, blue). White lines indicate the demarcations for different cortical regions (VZ, ventricular zone; SVZ, subventricular zone; IZ, intermediate zone; CP, cortical plate; loCL, lower cortical layer; upCL, upper cortical layer; WM, white matter). For additional data, see Figure S3. (D) Coronal brain sections from E14.5 CLASP2 shRNA electropo- ration and analyzed at P14 were immunostained with layers II/III marker CDP (red). (E and F) Representative images of morphological defects of CLASP2 shRNA neurons in the upCL and loCL. CLASP2 knockdown caused an increase in the number of primary neurites independent of cortical layer (control, n = 53 cells; CLASP2 shRNA upCL, n = 60 cells; CLASP2 shRNA loCL, n = 39 cells were analyzed). For addi- tional data, see Figure S4. Data are means ± SEM and statistical significance was assessed using one-way ANOVA (*p < 0.05, **p < 0.001, ***p < 0.0001). Scale bar represents 50 mm (A–D) and 10 mm (E).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Migration, In Utero, Control, shRNA, Transfection, Marker, Knockdown

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 5. CLASP2 Is Required for Neuronal Polarity Mouse embryos were electroporated in utero with GFP-tagged CLASP2 shRNAs or scrambled control at E14.5 and analyzed at P0. (A) Morphological and quantitative analysis of migrating GFP- positive neurons showing the length of the leading process (control, n = 44 cells; CLASP2 shRNA, n = 34 cells). (B and C) Representative images of the angle of the leading proess in relation to the pial surface. The angle was measured by using the closest connecting line from the cell soma to the pia (control, n = 20 cells; CLASP2 shRNA, n = 23 cells). The percentage of cells with a leading process oriented between 0–10, 11–90, and 91–180 to the pia were quantitated. (D) Immunohistochemical analysis of ascending radial glial fibers immunostained against Nestin (red) showed normal stereotypi- cal radial fibers spanning the entire cortical wall in control and CLASP2 shRNA cortex, oriented from the VZ toward the pial surface (VZ, ventricular zone; SVZ, subventricular zone; IZ, in- termediate zone; CP, cortical plate). Data are means ± SEM (A–C) and statistical significance was assessed using unpaired t test (***p < 0.0001). Scale bar rep- resents 10 mm (A and C), 20 mm (B), and 25 and 50 mm for (D).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: In Utero, Control, shRNA, Immunohistochemical staining

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 6. CLASP2 Is Necessary for Centrosome-Golgi Localization (A and B) Immunostaining for Pericentrin (red) shows centrosome localization and demonstrates a shorter distance between the nucleus and centrosome in CLASP2 knockdown neurons (control, n = 43 cells; CLASP2 shRNA, n = 53 cells). Nuclei were stained with DAPI (blue).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Immunostaining, Knockdown, Control, shRNA, Staining

Journal: Neuron

Article Title: CLASP2 Links Reelin to the Cytoskeleton during Neocortical Development.

doi: 10.1016/j.neuron.2017.02.039

Figure Lengend Snippet: Figure 8. GSK3b Phosphorylation of CLASP2 Regulates Cell Motility and Neurite Extension (A) Table lists several CLASP2 phosphopeptides identified by tandem mass spectrometry showing changes following Reelin treatment of mouse primary neurons. The first two columns indicate the start and end position of the peptides within the mouse CLASP2g sequence. The amino acid sequence is indicated with the putative phos- phorylation site (marked in red) followed by the position of the residue within CLASP2g. Ascore represents the probability of correct phosphory- lation site localization based on the presence and intensity of site-determining ions from the MS/MS spectra. H/L represents the ratio of signal of the specific phosphopeptide in Reelin (H) or control (L) treated neurons. For additional data, see Figures S6 and S7. (B) Representative images of primary dissociated mouse wild-type neuron cultures co-infected with scrambled control, CLASP2 shRNAs or CLASP2 shRNAs with CLASP2-wild-type (WT), CLASP2- 9S/A, or -8S/D phospho mutants and immuno- stained against tau axonal marker at 2 days in vitro. (C) CLASP2 shRNA caused a decrease in axon length when compared to control. Both CLASP2- WT and phospho-resistant CLASP2-9S/A rescued the CLASP2 shRNA phenotype, whereas phos- pho-mimetic CLASP2-8S/D was unable to rescue the axonal effects of CLASP2 knockdown (control, n = 19; CLASP2 shRNA, n = 28; CLASP2-WT, n = 21; CLASP2-9S/A, n = 17; CLASP2-8S/D, n = 33 cells). (D) Primary mouse wild-type neuron cultures were co-infected with scrambled control, CLASP2 shRNAs or CLASP2 shRNAs with CLASP2-wild- type (WT), CLASP2-9S/A, or -8S/D phospho mutants and cell migration was assessed by measuring the area of migration away from the initial aggregates over a 48 hr period. (E) CLASP2 shRNA caused a decrease in migration area compared to control (control, n = 8; CLASP2 shRNA, n = 8 aggregates). (F and G) Phospho-mimetic CLASP2-8S/D was unable to rescue the deleterious effects of CLASP2 shRNA on cell motility compared to CLASP2 WT and CLASP2-9S/A phosphomutant (control, n = 8; CLASP2 shRNA, n = 8; CLASP2- WT, n = 5; CLASP2-9S/A, n = 9; CLASP2-8S/D, n = 13 aggregates). Data are means ± SEM and statistical significance was assessed using one-way ANOVA (*p < 0.05). Scale bar represents 10 mm (B) and 50 mm (D).

Article Snippet: The shRNA constructs for mouse CLASP2 (shRNA-A GCATCAGTCCTTTCAACAAGT and shRNA-B GAACTTGAAGAGACGTTAAAT) and control scrambled shRNA (CCGCAGGTATGCACGCGT) were subcloned into the pLKO.1 (Addgene plasmid 10879), pSico (Addgene plasmid 11578) and pCGLH vectors for lentivirus and in utero electroporation studies, respectively.

Techniques: Phospho-proteomics, Mass Spectrometry, Sequencing, Residue, Tandem Mass Spectroscopy, Control, Infection, Staining, Marker, In Vitro, shRNA, Knockdown, Migration